Glutathionylation-Activated DCAF11-Dependent Molecular Glue Degrader

Compounds and Chemical Reagents

dBET6 (HY-112588), dBRD9 (HY-117690), MLN7243 (HY-100487), MLN4924 (HY-70062), MG132 (HY-13259), bafilomycin A₁ (HY-100558), and the 5K Scaffold Library (HY-L902) were purchased from MedChemExpress.

Plasmids and Expression Constructs

The study used the Artichoke plasmid (Addgene #73320) and Cilantro plasmid (Addgene #74450) for flow-based reporter degradation assays, reporter CRISPR screens, and co-immunoprecipitation experiments. The sgBFP plasmid (U6.sgRNA.SFFV.tBFP) was used to validate DCAF11 knockout phenotypes, while pNTM2 (CMV) was used for co-immunoprecipitation. pAC8-derived plasmids were used for recombinant protein expression and purification.

All recombinant proteins were generated from human sequences, including full-length DCAF11, DDX18 residues 171–625, DDB1(ΔBPB) containing residues 1–395 and 706–1140 connected by a GNGNSG linker, and full-length DDA1. N-terminal affinity tags included Flag for DCAF11 and DDX18, Flag–GFP for DDX18, StrepII–Avi for DCAF11 and DDX18, and His tags for DDB1(ΔBPB) and DDA1. The constructs were subcloned into pAC-derived expression vectors, including pAC8RedNK⁴⁵.

Antibodies Used for Protein Detection

The following primary and secondary antibodies were used: Flag (CST 14793S), GFP (CST 2555S), β-actin (CST 3700S), tubulin (Sigma T9026), BRD4 (Bethyl A301-985A-T), DDX18 (GeneTex GTX103392), BRD9 (Bethyl A303-781A-T), SMARCA2 (Bethyl A301-015A-T), LIMK2 (CST 3845 T), WEE1 (CST 4936S), CDK7 (Proteintech 27027-1-AP), cyclin H (Proteintech 67065-1-lg), MNAT1 (Proteintech 11719-1-AP), DCAF11 (Novus Biologicals NBP2-92244), IRDye 800CW Goat anti-Rabbit IgG Secondary Antibody (LI-COR 926-32211), and IRDye 680LT Goat anti-Rabbit IgG Secondary Antibody (LI-COR 925-68021).

Recombinant Protein Expression and Purification

Recombinant proteins encoded by the pAC-derived vectors were expressed in Trichoplusia ni High Five insect cells (Gibco, 85502) using a baculovirus expression system. Briefly, expression plasmids were transfected into Spodoptera frugiperda Sf9 cells (Expression Systems, 94-001 F) at 0.9 × 10⁶ cells per ml in ESF 921 medium (Expression Systems) to generate baculovirus. Two additional rounds of infection in Sf9 cells were performed to increase viral titres.

For recombinant protein production, High Five cells were cultured in SF-4 Baculo Express insect medium (BioConcept) at 2.0 × 10⁶ cells per ml and infected with baculovirus at a 1.5% v/v ratio. After 42 h at 27 °C, cells were harvested by centrifugation for 15 min at 1,500 rpm.

For purification of StrepII- or Flag-tagged proteins, cell pellets were resuspended in lysis buffer containing 50 mM Tris(hydroxymethyl)aminomethane hydrochloride (Tris-HCl), pH 8.0, 200 mM NaCl, 1 mM tris(2-carboxyethyl)phosphine (TCEP), and protease inhibitors. Cells were lysed by sonication, followed by ultracentrifugation for 1 h at 40,000 rpm and 4 °C. The soluble fraction was loaded onto Strep-Tactin XT Superflow resin (IBA 2-4010-025) or Anti-DYKDDDDK G1 Affinity Resin (Genscript L00432). Proteins were eluted with wash buffer containing 50 mM Tris-HCl, pH 8.0, 200 mM NaCl, and 1 mM TCEP, supplemented with either 50 mM biotin (IBA 2-1016-005) or 0.15 mg ml⁻¹ Flag peptide by custom synthesis.

Affinity-purified proteins were further separated by ion-exchange chromatography on a POROS 50HQ column (Thermo Scientific 1255911). Proteins were eluted in 50 mM Tris-HCl, pH 8.5, and 2 mM TCEP using a linear NaCl gradient from 50 mM to 1,000 mM. All proteins were then subjected to size-exclusion chromatography on a Superdex 200 Increase 10/300 column (Cytiva 28990944) equilibrated in 25 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), pH 7.4 or 8.0, 150 mM NaCl, and 1 mM TCEP. Non-concentrated peak fractions were used for structural biology experiments. For biochemical assays, peak fractions were pooled, concentrated, flash frozen in liquid nitrogen, and stored at −80 °C.

In Vitro Protein Biotinylation

Purified StrepII–Avi-tagged DCAF11 or DDX18 was biotinylated in vitro by incubation with 2.5 μM BirA enzyme, prepared in-house, and 0.2 mM biotin in 50 mM HEPES, pH 7.4, 200 mM NaCl, 10 mM MgCl₂, 1 mM TCEP, and 20 mM ATP. Reactions were incubated for 1 h at room temperature and then stored overnight at 4 °C. Biotinylated proteins were purified by size-exclusion chromatography, flash frozen in liquid nitrogen, and stored at −80 °C.

Time-Resolved Fluorescence Resonance Energy Transfer (TR-FRET)

Compound titrations used to induce formation of the DCAF11–DDX18 complex were performed by mixing biotinylated DCAF11, GFP–DDX18 at the concentrations specified in the figure legends, and 2 nM terbium-conjugated streptavidin, prepared in-house. Assays were performed in 50 mM HEPES, pH 8.0, 200 mM NaCl, 1 mM TCEP, 0.05% Tween-20, and 1 mM TCEP.

To prepare lysate buffer, 2 × 10⁷ HEK293T cells were lysed by sonication. After centrifugation at 15,000 rpm for 30 min at 4 °C, the soluble fraction was used as lysate buffer. GST- and reduced GSH-mediated TR-FRET assays contained 0.5 mg ml⁻¹ GST and 0.2 mg ml⁻¹ reduced GSH.

Assay mixtures were dispensed at a final volume of 15 μl into 384-well microplates (Corning 4514). Increasing compound concentrations were added with a D300e Digital Dispenser (HP), followed by incubation for 1 h at room temperature. Terbium fluorescence was excited at 337 nm, and emissions at 490 nm for terbium and 520 nm for GFP were recorded with a 70-μs delay over 600 μs to minimize background fluorescence. Each data point was monitored for 60 cycles using a PHERAstar FS microplate reader (BMG Labtech). TR-FRET signals were calculated as the 520/490 nm emission ratio, and dose–response curves were generated in GraphPad Prism. Technical replicate numbers are provided in the figure legends.

Titrations of BODIPY-labelled M12, BODIPY-labelled GSH, or GFP–DDX18 were performed by mixing biotinylated DCAF11 or DDX18 at the concentrations specified in the figure legends with 2 nM terbium-conjugated streptavidin in assay or lysate buffer. Increasing concentrations of BODIPY–M12 were added to 384-well plates with a D300e Digital Dispenser and incubated for 1 h at room temperature. Ratios from samples containing biotinylated protein were background corrected by subtracting ratios from samples without protein. Corrected values were plotted in GraphPad Prism. Technical replicate numbers are indicated in the figure legends.

Multiplexed Immunoprecipitation and Mass Spectrometry Sample Preparation

DMSO, CC-885 as a positive control at 31.25 µM, or pools of 320 compounds at 31.25 µM were dispensed at 6 µl per well into 96-well plates in triplicate. A total of 1 × 10⁹ frozen cells, comprising 8 × 10⁸ Expi293, 5 × 10⁷ K562, 1 × 10⁸ U937, and 5 × 10⁷ Hep3B cells, were resuspended in 20 ml lysis buffer containing 50 mM Tris, pH 8.0, 200 mM NaCl, 2 mM TCEP, 0.1% NP-40, 2 µl Benzonase (EMD Millipore 77664-3), and one cOmplete protease inhibitor tablet.

Cell suspensions were sonicated on ice for 20 cycles of 3 s on and 5 s off at 25% amplitude. Following centrifugation, 504 µl of each of seven bait proteins, at 15 µM, was added to 9.5 ml clarified lysate. Then, 125 µl of the lysate–protein mixture was transferred to each well containing compounds. Plates were incubated on ice for 1 h before adding 50 µl of pre-washed MagStrep Strep-Tactin XT beads (IBA 2-5090-010). The final reaction contained 90 µl lysate, 6 µl compound pool, 25 µl protein, and 50 µl resin, with each compound at a final concentration of 1.1 µM.

Bead mixtures were incubated for an additional hour on ice. Beads were washed with 50 mM Tris, pH 8.0, and 2 mM TCEP containing the corresponding compound pool. Elution was performed with 0.5 M NaOH. Eluates were immediately neutralized with 0.1 M Tris, pH 2.0, to a final pH of 8.5 and volume of 200 µl.

Samples were reduced with 10 mM TCEP for 30 min at room temperature on a thermomixer and alkylated with 15 mM iodoacetamide (Sigma I1149) for 45 min protected from light. The reaction was quenched with DTT at a final concentration of 10 mM. Proteins were digested overnight at 37 °C with 3 µg Trypsin/Lys-C Mix, Mass Spec Grade (Promega V5072). Digests were acidified with formic acid to pH 2–3 and desalted using C18 solid-phase extraction plates (Thermo Scientific 60307). Peptides were vacuum dried and reconstituted in 0.1% formic acid for LC–MS analysis. Multiplexed immunoprecipitation samples were analysed using the DDA workflow described below, whereas non-multiplexed immunoprecipitation samples were analysed using the diaPASEF workflow.

Whole-Cell Quantitative Proteomics Sample Preparation

Treated cells were lysed in buffer containing 8 M urea, 50 mM NaCl, 50 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (EPPS), pH 8.5, and protease and phosphatase inhibitors. Samples were homogenized by bead beating in a BioSpec instrument for three 30-s cycles at 2,400 strokes per min. Protein quantification, tryptic digestion, and C18 desalting were performed as previously described⁴⁶. Whole-cell quantitative proteomics data were collected using the diaPASEF method described below.

LC–MS Data Collection and Analysis Using diaPASEF

Data were acquired with a TimsTOF HT mass spectrometer (Bruker Daltonics) coupled to a nanoElute2 liquid chromatography pump (Bruker Daltonics), as previously described^19,46. Raw diaPASEF files were processed with library-free analysis in DIA-NN⁴⁷ against the January 2021 Swiss-Prot human database. Default directDIA settings were used, including tryptic digestion with up to two missed cleavages, carbamidomethylation of cysteine, oxidation of methionine, and a precursor Q-value false discovery rate threshold of 0.01. Precursor quantification used Robust LC with high accuracy and retention-time-dependent cross-run normalization.

For global proteomics, proteins with low total abundance, defined as less than 2,000 multiplied by the number of treatments, were excluded. The remaining data were filtered to retain proteins with at least three counts in at least three or four replicates for each independent treatment-versus-DMSO comparison.

For multiplexed immunoprecipitation proteomics, proteins were retained when they had at least three precursor counts in at least four replicates for each independent treatment-versus-DMSO comparison. Protein abundances were globally normalized using in-house scripts in the R framework.

Missing protein values were imputed by random sampling from a Gaussian distribution. The distribution was based on the mean of non-missing values for the relevant treatment group or, when all values were missing for a treatment group, on the median background abundance. Significant differences between treatment and DMSO controls were assessed using a two-sided moderated t-test implemented in the limma package within R⁴³.

LC–MS Data Collection and Analysis Using DDA

Data were acquired using an Orbitrap Exploris 480 mass spectrometer (Thermo Fisher Scientific) coupled to an UltiMate 3000 RSLCnano system. Peptides were separated on an Aurora 25 cm × 75 μm inner-diameter microcapillary column (IonOpticks) with a 60-min gradient of 5–25% acetonitrile in 1.0% formic acid at 250 nl min⁻¹. Each analysis used a TopN data-dependent acquisition method. MS1 data were collected over m/z 350–1,200 at a resolution of 60,000, with a 300% normalized AGC target, automatic maximum injection time, 30-s dynamic exclusion, and precursor charge states of 2–6. TopN 40 MS2 spectra were acquired from m/z 110, at a resolution of 15,000, using a 1.4 m/z isolation window, 30% HCD normalized collision energy, standard AGC target, and automatic maximum injection time.

Additional data were collected with an Orbitrap Eclipse mass spectrometer (Thermo Fisher Scientific) coupled to an UltiMate 3000 RSLCnano system. Peptides were separated on a 50 cm × 75 μm EasySpray ES903 microcapillary column (Thermo Fisher Scientific) using either a 60-min gradient of 6–22% acetonitrile or a 60-min gradient of 5–25% acetonitrile in 1.0% formic acid at 350 nl min⁻¹. A cycle-time data-dependent acquisition method with a 3-s cycle time was used.

Full MS1 scans were acquired in the Orbitrap at a resolution of 120,000 over m/z 375–1,325, with a maximum injection time of 200 ms and an AGC target of 4 × 10⁵. Precursors with charge states of 2–6 and intensities above 20,000 were selected for fragmentation with 30-s dynamic exclusion. MS2 scans were acquired in the Orbitrap at a resolution of 30,000 using HCD fragmentation, 35% normalized collision energy, a quadrupole isolation window of 0.5 m/z, and a 54-ms maximum injection time. The MS2 AGC target was 5 × 10⁴, and data were collected in centroid mode.

Proteome Discoverer 2.4 or 2.5 (Thermo Fisher Scientific) was used to process RAW files, control peptide- and protein-level false discovery rates, assemble proteins from peptides, and quantify peptides and proteins. MS/MS spectra were searched against the January 2021 Swiss-Prot human database containing forward and reverse sequences and common contaminants, including human keratins.

Search parameters included tryptic digestion with two missed cleavages, a precursor mass tolerance of 10 ppm, fragment-ion mass tolerance of 0.03 or 0.06 Da, static cysteine alkylation of 57.0215 Da, and variable modifications consisting of methionine oxidation of 15.9949 Da, N-terminal acetylation of 42.0106 Da, and optional phosphorylation of serine, threonine, and tyrosine of 75.966 Da. Peptides were quantified by MS1 intensity, and peptide abundances were summed to determine protein abundance.

Data were filtered to retain proteins with at least two counts in at least two replicates for each independent treatment-versus-DMSO comparison. Protein abundances were globally normalized using in-house R scripts. Missing values were imputed by random selection from a Gaussian distribution based on the mean of non-missing values for the treatment group or the median background abundance when all values for a treatment group were missing. Significant treatment-associated changes were assessed using a two-sided moderated t-test implemented in the limma package within R⁴³.

Quantitative PCR Analysis

Jurkat cells, 1 × 10⁶ per sample, were treated with DMSO or 20 µM M12 for 18 h, collected by centrifugation, washed with phosphate-buffered saline (PBS), and flash frozen at −80 °C. Messenger RNA was isolated using the QIAGEN RNeasy Plus kit (Qiagen 74134). One microgram of RNA was reverse transcribed using the iScript cDNA Synthesis Kit (Bio-Rad 1708891).

Quantitative PCR was performed with TaqMan Gene Expression Master Mix (Applied Biosystems 4369016) using assays for DDX18 (Life Technologies TaqMan Hs00705691_s1) and GAPDH (TaqMan Hs02786624_g1). Reactions were run and analysed on a QStudio 6 FLX Real-Time PCR System (Applied Biosystems). Relative expression was calculated using the ∆∆Cq method, with Cq values normalized to GAPDH and M12-treated samples normalized to DMSO-treated samples.

Immunoblotting and Western Blot Analysis

Cells were washed with PBS and lysed in RIPA buffer (Thermo Scientific 89901) supplemented with cOmplete Protease Inhibitor Cocktail (Sigma 11836170001) for 20 min on ice. Insoluble material was removed by centrifugation. Protein concentration was determined using a BCA assay kit (Thermo Scientific 23227). Equal quantities of protein were separated on 4–12% Bis-Tris SDS–PAGE gels (Thermo Scientific) and transferred to nitrocellulose membranes using an XCell II Blot Module Wet Tank Transfer System (Thermo Scientific).

Membranes were blocked with Intercept PBS Blocking Buffer (LI-COR Biosciences 927-70001) and incubated overnight at 4 °C with primary antibodies. After washing with Tris-buffered saline containing Tween-20 (TBS-T), membranes were incubated for 1 h with IRDye-conjugated secondary antibodies. Membranes were washed three times in TBS-T for 5 min and imaged using an Odyssey near-infrared imaging system and Image Studio software (LI-COR Biosciences).

Co-Immunoprecipitation Assay

Five million HEK293T cells expressing DDX18–eGFP from the Cilantro plasmid were plated in 10-cm dishes. After 1 day, cells were transiently transfected with 5 µg of Flag-tagged wild-type or mutant DCAF11 in the pNTM plasmid using TransIT-LT1 (Mirus MIR 2304). After a further 24 h, cells were treated with 1 µM MLN4924 for 1 h and then with 10 µM M12 for 6 h.

Cells were harvested, washed with PBS, and lysed for 30 min on ice in Pierce IP lysis buffer (Thermo Scientific 87787) supplemented with cOmplete protease inhibitor cocktail. Samples were vortexed every 10 min and centrifuged for 10 min to remove insoluble material. M12 was included in the lysis and wash buffers for samples treated with M12.

After washing with IP lysis buffer, 25 µl of Anti-DYKDDDDK Magnetic Agarose (Thermo Scientific A36797) was added to each lysate. Samples were incubated overnight at 4 °C on a rotator. Beads were washed three times with IP lysis buffer and boiled in 1× NuPAGE LDS sample buffer (Invitrogen NP0007). Immunoblotting was performed as described in the immunoblotting section.

Generation of Reporter Cell Lines

Reporter plasmids were transformed into Stbl3 Escherichia coli and purified with a MiniPrep Kit (Invitrogen K210011). Plasmid sequences were verified by Sanger sequencing (Quintara Biosciences).

Lentiviral reporter particles were produced by seeding 0.55 × 10⁶ HEK293T cells in 2 ml DMEM. The following day, 1.5 µg psPAX2, 0.15 µg pVSV-G, and 1.5 µg transgene plasmid were combined in 37.5 µl Opti-MEM (Gibco 31985070). The mixture was combined with 9 µl TransIT-LT1 and 15 µl Opti-MEM, incubated for 30 min at room temperature, and added dropwise to the cells. Cells were incubated for an additional 48 h.

Lentiviral supernatants were collected through 0.4-µm filters and used to transduce 1 × 10⁶ HEK293T-Cas9 or K562-Cas9 cells by spin infection at a 10% volume ratio. One day after infection, reporter cells were selected with 2 μg ml⁻¹ puromycin.

Fluorescent Reporter Degradation Assays

K562-Cas9 cells stably expressing DDX18 or BRD4 fluorescent reporters were treated with DMSO or degraders at the indicated concentrations and time points using a D300e Digital Dispenser (HP). Fluorescence was measured by flow cytometry using a Symphony flow cytometer and BD FACSDiva 8.0 software (BD Biosciences). The gating strategy is shown in Supplementary Fig. 2a. Data were analysed with FlowJo v10.

The geometric mean fluorescence of eGFP and mCherry was calculated for round, mCherry-positive cells. GFP fluorescence was normalized to the mCherry signal, and drug-treated samples were compared with DMSO controls. Technical replicate numbers are provided in the figure legends. Data represent one independent representative experiment.

Genome-Scale and UPS-Targeted DDX18 Reporter CRISPR Screens

Viruses containing either the genome-scale Brunello sgRNA library (Addgene #73178) or the ubiquitin–proteasome system (UPS)-targeted BISON sgRNA library (Addgene #169942) were spin infected into K562-Cas9 cells expressing the DDX18–eGFP stability reporter at a 10% volume ratio. Transduced cells were allowed to recover and expand for 7 days for the Brunello library and 14 days for the BISON library.

Cells were then treated with DMSO or 10 µM M12 for 18 h. The top and bottom 5% of cells, based on eGFP/mCherry fluorescence ratios, were sorted into stable and unstable gates, respectively, in two replicate experiments. The gating strategy is shown in Supplementary Fig. 2b.

Sorted cells were pelleted and lysed. sgRNAs were amplified, quantified by next-generation sequencing, and analysed for enrichment in the stable gate relative to the unstable gate, representing rescue of reporter degradation. Data were analysed as previously described⁴⁸ using R v4.5.1 and RStudio v2025.05.1+513 with tidyverse v2.0.0, ggrepel v0.9.8, GGally v2.4.0, dr4pl v2.0.0, and ShortReads, Bioconductor v3.2.4.

Single-Gene Knockout Validation

Guide RNAs targeting genes of interest were cloned into the sgBFP vector by BsmBI digestion and ligation as previously described⁴⁸. Lentivirus was produced as described above, and K562-Cas9 cells expressing the DDX18 stability reporter were transduced with the corresponding sgRNAs.

Seven days after infection, knockout effects were determined by measuring GFP/mCherry ratios in BFP-positive and BFP-negative populations by flow cytometry. The guide RNA sequences were: sgDCAF11 #1, TGTGGGATCGACGCACCATG; sgDCAF11 #2, CGCCTAGATTGAGTCCCATG; sgDCAF11 #3, AGACGCTCCAGCCTACGTCG; and sgDCAF11 #4, AGAGGGTAAGTTACCTGCGG.

In Vitro Reconstitution of GSH–M12

A 500-µl frozen aliquot of the DCAF11–DDB1(ΔBPB)–DDA1–DDX18 complex, containing 2.5 mg ml⁻¹ protein and formed in the presence of 10 µM M12, was thawed. An equal volume of acetonitrile was added to precipitate proteins. The opaque mixture was centrifuged at 15,000 rpm for 10 min at 4 °C. The supernatant was analysed by UPLC–MS/MS (Waters) to obtain low-resolution unit-mass spectrometric data.

In Vitro Glutathionylation of M12 by GSH and GST

M12 at 1 µM, GST at 0.5 mg ml⁻¹ purified in-house, and reduced GSH at 0.2 mg ml⁻¹ (Sigma G4251) were incubated in 100 µl of 50 mM Tris, pH 8.0, and 200 mM NaCl for 30 min at room temperature. An equal volume of acetonitrile was added to precipitate proteins. The opaque mixture was centrifuged at 15,000 rpm for 10 min at 4 °C, and the supernatant was analysed by UPLC–MS/MS (Waters) to obtain low-resolution unit-mass spectra.

LC–MS/MS Quantification of GSH–M12 in Cell Media and Lysates

GSH–M12 concentrations in cell culture media and lysates were measured using a validated LC–MS/MS bioanalytical method. A 50-µl aliquot of each sample was mixed with 50 µl methanol/water at an 80:20 v/v ratio, vortexed for 10 min, and centrifuged at 4,000 rpm for 10 min at 4 °C before injection. Calibration standards and quality-control samples were prepared in pooled DMSO-treated cell medium or lysate, respectively.

The LC–MS/MS system consisted of a Shimadzu Nexera X2 UHPLC coupled to a Sciex 5500 triple-quadrupole mass spectrometer operated in ESI+ mode. Source parameters were: GS1, 55 psi; GS2, 55 psi; curtain gas, 30 psi; collision gas, 9 psi; source temperature, 550 °C; and ion-spray voltage, 4,000 V.

GSH–M12 was separated on a Supelco Ascentis Express C18 column measuring 2.1 × 30 mm with 2.7 µm particles and 90 Å pores. Mobile phase A consisted of 5 mM ammonium acetate in water with 1% v/v formic acid. Mobile phase B consisted of 1 mM ammonium acetate in 95:5 v/v acetonitrile/water with 0.025% formic acid. The gradient was 1% B from 0.00–0.30 min, 1–95% B from 0.30–1.40 min, 95% B from 1.41–2.00 min, 95–1% B from 2.00–2.01 min, and 1% B from 2.01–2.40 min. The flow rate was 0.5 ml min⁻¹, column temperature was 40 °C, and injection volume was 5 µl.

GSH–M12 was detected using the multiple-reaction monitoring transition m/z 585.022 > 456.026. The retention time was 1.35 min, and the method was validated over a concentration range of 0.5–500 ng ml⁻¹ in cell medium and lysate.

Identification of M12 Metabolites in Cell Lysates

M12 metabolites in cell lysates were characterized using high-resolution mass spectrometry (HRMS). A 50-µl sample aliquot was mixed with 50 µl methanol, vortexed, and centrifuged at 12,000 rpm for 10 min at 4 °C before LC–MS injection. DMSO-treated cell lysates served as negative controls.

HRMS analysis was performed with a Thermo Vanquish Horizon UHPLC system coupled to a Thermo LTQ Orbitrap Elite mass spectrometer operated in ESI+ mode. Source settings were: heat temperature, 375 °C; sheath gas flow, 45; auxiliary gas flow, 10; sweep gas flow, 3; spray voltage, 4.10 kV; capillary temperature, 320 °C; and S-lens RF level, 55%. LC–HRMS data were analysed using Mass-MetaSite software (Mass Analytica).

M12 metabolites were separated on a Waters Acquity UPLC BEH C18 column with 1.8 µm particles and dimensions of 2.1 mm × 100 mm. Mobile phase A was water containing 1% v/v formic acid, and mobile phase B was acetonitrile containing 1% v/v formic acid. The gradient was 5% B from 0–2 min, 5–75% B from 2–12 min, 75–95% B from 12–14 min, 95% B from 14–16 min, 95–5% B from 16–16.5 min, and 5% B from 16.5–18 min. The column temperature was 40 °C, flow rate was 0.5 ml min⁻¹, and injection volume was 10 µl.

In Vitro Neddylation and Ubiquitination Assays

CUL4–RBX1 neddylation was performed as previously described. Briefly, 12 µM CUL4–RBX1, 1 µM UBE2M, 0.2 µM APPBP1–UBA3, and 25 µM NEDD8 were incubated for 10 min at room temperature in 25 mM HEPES, 100 mM NaCl, 10 mM MgCl₂, and 5 mM ATP, pH 7.5. Reactions were quenched with 20 mM DTT and further purified by size-exclusion chromatography in 25 mM HEPES, 200 mM NaCl, and 1 mM TCEP, pH 7.5.

For GFP–DDX18 ubiquitination, 500 nM neddylated CUL4–RBX1 was incubated with 700 nM DCAF11–DDB1–DDA1 and 1 µM GFP–DDX18 in the presence of buffer, M12, or GSH–M12 on ice for 20 min. Reactions were performed in 25 mM HEPES, 100 mM NaCl, 10 mM MgCl₂, and 5 mM ATP, pH 7.5, with 2 µM UBE2D, 2 µM UBE2G1, and 0.2 µM UBA1. Reactions were initiated by adding 60 µM ubiquitin at room temperature. Aliquots were collected at the indicated time points, quenched with SDS sample buffer, and separated by SDS–PAGE. GFP–DDX18 fluorescence was detected using an Amersham Typhoon gel scanner.

Cryo-EM Sample Preparation and Data Collection

DCAF11, DDX18 residues 171–625, DDB1(ΔBPB) residues 1–395 and 706–1140, and DDA1 were purified in the presence of 10 μM M12. Samples were applied to freshly glow-discharged Quantifoil UltraAuFoil grids, either R0.6/1 or R1.2/1.3, following glow discharge at 20 mA for 2 min.

Samples were incubated for 10 s at 10 °C and 90% relative humidity before blotting for 5 s, or 2 s for R1.2/1.3 grids. After blotting, samples were plunge frozen into liquid ethane using a Leica EM GP1 plunger (Leica Microsystems), with a 3-s wait time or no wait time for R1.2/1.3 grids.

Cryo-EM data were collected at the Harvard Cryo-Electron Microscopy Center for Structural Biology using a Titan Krios electron microscope (Thermo Fisher) operated at 300 kV and equipped with a Falcon 4i detector. Movie stacks were automatically acquired using Thermo Scientific Smart EPU software. Data from both grids were combined. In total, 10,632 movies were collected at a total dose of 52 e⁻ Å⁻² over 54 frames, with a pixel size of 0.73 Å, nominal magnification of 165,000×, and defocus range of −0.6 to −2.0 μm.

Cryo-EM Data Processing and Atomic Model Building

All cryo-EM image processing was conducted in cryoSPARC v4.5.3 and v4.6.2⁴⁹. The 10,632 movies were corrected for beam-induced motion, and contrast transfer functions were estimated in cryoSPARC Live. Template-based particle picking identified 6,549,850 particles, which were subjected to 2D classification.

Several rounds of heterogeneous refinement produced an initial consensus reconstruction from 191,769 particles at 2.52 Å resolution. This map was used as a seed model to classify 3,767,503 particles identified by TOPAZ particle picking v0.2.5a. Consensus refinement of 676,855 particles produced a 2.61 Å map.

Additional heterogeneous refinement and 3D classification enriched the DDX18 density and generated a 2.35 Å reconstruction from 131,583 particles after reference-based motion correction, global contrast transfer function refinement, and local contrast transfer function refinement. Local refinement with a soft mask covering DDX18 produced a 2.38 Å reconstruction. The two maps were combined into a final composite map using ChimeraX. Unsharpened and sharpened maps were used for model building in Coot v0.9.8.92 EL⁵⁰.

The DDB1(ΔBPB) structure from PDB 5FQD and AlphaFold predictions for DCAF11 and the DDX18 C-terminal lobe, residues 402–621, were rigid-body fitted into the cryo-EM density using ChimeraX v1.8⁵¹ and relaxed into the density with ISOLDE v1.8⁵². GSH–M12 was built de novo and fitted into the density between DCAF11 and DDX18. The model was iteratively refined in PHENIX real-space refinement v1.21.2-5419^53,54 against the composite map and manually inspected in Coot.

The non-uniform refinement, DDX18 local-refinement, and composite maps were deposited in the Electron Microscopy Data Bank under accession codes EMD-71834, EMD-71833, and EMD-71847, respectively. The DDX18–GSH–M12–DCAF11–DDB1(ΔBPB) atomic model was deposited in the Protein Data Bank under accession code 9PTU. Structural biology software used in this study was compiled and configured by SBGrid⁵⁵.

Chemical Synthesis

Detailed chemical synthesis procedures are provided in the Supplementary Information.

Reporting Summary

Additional information about the study design and experimental reporting is available in the Nature Portfolio Reporting Summary linked to this article.